high fidelity restriction enzyme bamhi (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
high fidelity restriction enzyme bamhi
High Fidelity Restriction Enzyme Bamhi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13260 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bamhi/BamHI/pmc13183001-150-4-8
Average 99 stars, based on 13260 article reviews
High Fidelity Restriction Enzyme Bamhi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 13260 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bamhi/BamHI/pmc13183001-150-4-8
Average 99 stars, based on 13260 article reviews
high fidelity restriction enzyme bamhi - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Isolation:Article Title: Transcription and cohesin direct domain boundary spatial positioning and are linked to Friedreich's ataxia. Article Snippet: .. To generate pLJM1-Smc3, pLJM1 (Addgene #19319) was digested with NheI (NEB R3131) and Agarose Gel Electrophoresis:Article Title: Transcription and cohesin direct domain boundary spatial positioning and are linked to Friedreich's ataxia. Article Snippet: .. To generate pLJM1-Smc3, pLJM1 (Addgene #19319) was digested with NheI (NEB R3131) and Extraction:Article Title: Transcription and cohesin direct domain boundary spatial positioning and are linked to Friedreich's ataxia. Article Snippet: .. To generate pLJM1-Smc3, pLJM1 (Addgene #19319) was digested with NheI (NEB R3131) and Purification:Article Title: Transcription and cohesin direct domain boundary spatial positioning and are linked to Friedreich's ataxia. Article Snippet: .. To generate pLJM1-Smc3, pLJM1 (Addgene #19319) was digested with NheI (NEB R3131) and Gel Extraction:Article Title: Transcription and cohesin direct domain boundary spatial positioning and are linked to Friedreich's ataxia. Article Snippet: .. To generate pLJM1-Smc3, pLJM1 (Addgene #19319) was digested with NheI (NEB R3131) and Plasmid Preparation:Article Title: Arylsulfatase L is a Golgi chondroitin sulfatase regulating skeletal development. Article Snippet: The rat Arsl sequence was then cloned into the p3XFLAG-CMV-14 plasmid (#E7908, Sigma-Aldrich) using the following primers: FLAG – rat Arsl Fw: 5’ CCCAAGCTTGGGATGGCTCCGCCC 3’; FLAG – rat Arsl Rev:3’ CGGGATCCGCTTCCGGCTCCCGCC 5’. .. The vector was digested using HindIII and Article Title: Disrupting SOX2 self-association and condensate formation to overcome chemotherapeutic drug resistance in lung squamous cell carcinoma Article Snippet: .. The resulting PCR products were recombined into the pHAGE-3 × Flag vector, which was digested with Article Title: Hemin activates interleukin-17 signaling and CCAAT/enhancer-binding protein beta to promote neuroinflammation and blood-brain barrier disruption. Article Snippet: Heme overload, a feature of hemolytic conditions and cellular injury, can initiate oxidative stress and inflammatory cascades that perturb neurovascular homeostasis.. However, the molecular mechanisms by which peripheral heme exposure disrupts blood–brain barrier (BBB) integrity remain incompletely defined.. Here, we investigated key molecular mediators linking peripheral hemin challenge to neurovascular injury. Ligation:Article Title: Arylsulfatase L is a Golgi chondroitin sulfatase regulating skeletal development. Article Snippet: The rat Arsl sequence was then cloned into the p3XFLAG-CMV-14 plasmid (#E7908, Sigma-Aldrich) using the following primers: FLAG – rat Arsl Fw: 5’ CCCAAGCTTGGGATGGCTCCGCCC 3’; FLAG – rat Arsl Rev:3’ CGGGATCCGCTTCCGGCTCCCGCC 5’. .. The vector was digested using HindIII and Polymerase Chain Reaction:Article Title: Disrupting SOX2 self-association and condensate formation to overcome chemotherapeutic drug resistance in lung squamous cell carcinoma Article Snippet: .. The resulting PCR products were recombined into the pHAGE-3 × Flag vector, which was digested with Homologous Recombination:Article Title: Disrupting SOX2 self-association and condensate formation to overcome chemotherapeutic drug resistance in lung squamous cell carcinoma Article Snippet: .. The resulting PCR products were recombined into the pHAGE-3 × Flag vector, which was digested with Cloning:Article Title: Enhanced Large-Scale Production and Purification of Recombinant Human NUPR1 for Detailed Structural and Functional Insights. Article Snippet: .. Restriction enzymes NcoI (5′-C^CATGG-3′) and Gel Purification:Article Title: Hemin activates interleukin-17 signaling and CCAAT/enhancer-binding protein beta to promote neuroinflammation and blood-brain barrier disruption. Article Snippet: Heme overload, a feature of hemolytic conditions and cellular injury, can initiate oxidative stress and inflammatory cascades that perturb neurovascular homeostasis.. However, the molecular mechanisms by which peripheral heme exposure disrupts blood–brain barrier (BBB) integrity remain incompletely defined.. Here, we investigated key molecular mediators linking peripheral hemin challenge to neurovascular injury. |